CPL - Chalmers Publication Library
| Utbildning | Forskning | Styrkeområden | Om Chalmers | In English In English Ej inloggad.

Fluorescence-detected interactions of oligonucleotides in RecA complexes

Pernilla Wittung (Institutionen för fysikalisk kemi) ; M. Funk ; B. Jernstrom ; Bengt Nordén (Institutionen för fysikalisk kemi) ; M. Takahashi
Febs Letters (0014-5793). Vol. 368 (1995), 1, p. 64-68.
[Artikel, refereegranskad vetenskaplig]

A technique has been developed to probe directly RecA-DNA interactions by the use of the fluorescent chromophore, (+)anti-benzo(a)pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), covalently attached to DNA, The 24-mer oligonucleotide 5'-d(CTACTAAACATGTACAAATCATCC) was specifically modified on the exocyclic nitrogen of the central guanine, to yield a trans-adduct. Upon interaction of the modified oligonucleotide with RecA we find an increase in BPDE fluorescence and a rather high fluorescence anisotropy, suggesting a restricted motion of the BPDE-oligonucleotide in the protein filament. In the presence of the cofactor ATP gamma S, binding of two oligonuclotides, identical or complementary in sequence, in the RecA filament is possible, The RecA-DNA complex is, however, more stable when the sequences are complementary; in addition, a shift in the BPDE emission peaks is observed, In the presence of ATP (and an ATP regeneration system), the RecA-DNA interaction between two complementary oligonucleotides is changed, and we now find protein-mediated renaturation to occur.

Nyckelord: reca, recombination, benzo(a)pyrenediolepoxide, renaturation, fluorescence, escherichia-coli, dna complexes, genetic-recombination, solution, conformation, linear dichroism, protein, stoichiometry, spectroscopy, coordination, mechanism



Denna post skapades 2011-08-17.
CPL Pubid: 144409

 

Läs direkt!


Länk till annan sajt (kan kräva inloggning)


Institutioner (Chalmers)

Institutionen för fysikalisk kemi (1900-2003)

Ämnesområden

Biokemi
Molekylärbiologi

Chalmers infrastruktur